BIOLOGY-XII
CHAPTER-BIOTECHNOLOGY PRINCIPLES AND PROCESSES
=====================================================================
PART A
1. A restriction endonuclease breaks bonds between the
a) Base pairs of a DNA molecule
b) Base pairs of a DNA-RNA hybrid molecule
c) Sugar and phosphate components of a nucleic acid molecule
d) Exons and introns of a DNA molecule

2. Assertion: In gel electrophoresis, DNA fragments get separated and move towards the anode.
Reason: DNA fragments are positively charged molecules.
a) Both A and R are true and R is the correct explanation of A
b) Both A and R are true but R is not the correct explanation of A
c) A is true but R is false
d) A is false but R is true

3. If the transformed host cells with ampicillin resistant gene are spread on agar plates containing ampicillin, which of the following condition results
a) Only transformants will grow and untransformed cells will die
b) Only untransformed cells will grow and transformants will die
c) Both transformants and untransformants will grow
d) Both transformants and untransformants will die

4. Restriction enzymes were isolated from one of the following
a) Plants 

 b) Animals 

 c) Viruses 

 d) Prokaryotic cells

5. The first step in recombinant DNA technology is
a) Insertion of the isolated gene into a vector
b) Selection of transformed host cell
c) Isolation of the desired gene
d) Ligation of the desired gene with a vector

6. Which of the following is a first restriction endonuclease?
a) pBR 322 

 b) Eco R I 

 c) Hind II 

 d) Sal I

7. In the name of a restriction enzyme E.coRI, the letter ‘R’ denotes
a) Name of the genus 

 b) Name of the species
c) Name of the strain 

 d) Order in which it was isolated from the cell

8. Identify from the following the genes in pBR322 which encode for resistance to antibiotics
I. Chloramphenicol II. Tetracycline III. Streptomycin IV. Ampicillin
a) I, II 

 b) II, III 

 c) II, IV

 d) III, IV

9. Which of the following method is suitable for plants to insert r-DNA?
a) Heat shock 

 b) Micro-injection
c) Biolistic method

 d) Disarmed pathogen vectors

10. Which of the following vectors are not used to introduce r-DNA into the competent host cells?
a) Plasmids

 b) Cosmids 

 b) Disarmed pathogens 

 d) Prions

11. Study the following lists
List I List II
A. Ti plasmid I. Thermostable DNA polymerase
B. Divalent cation II. Gene-specific probe
C. Repeated amplification III Competent host
D. Colony hybridization IV. Cloning Vector
V. Ribonuclease
The correct match is
a) A-V; B-II; C- IV; D-I 

 b) A-II; B-III; C-V; D-IV
c) A-IV; B-I, C-III; D-V 

 d) A-IV; B-III; C-I; D-II

12. Precipitates of purified DNA after the addition of chilled ethanol are seen as a collection of fine threads in suspension. This process is referred to as
a) DNA transformation 

 b) DNA ligation
c) DNA spooling 

 d) DNA duplication

13. In a polymerase chain reaction after the denaturation step, the mixture needs to cool down to a lower temperature
a) To permit specific annealing of the primers
b) To give a halt to the reaction mixture
c) To increase the activity of enzyme Taq polymerase
d) To obtain the multiple copies of the DNA

14. The term ‘chimeric DNA’ refers to
a) DNA with overhanging stretches

 b) DNA with palindromic sequence
c) A recombinant DNA 

 d) Molecular scissors

15. Which of the following has popularized the PCR (polymerase chain reactions)?
a) Easy availability of DNA template.
b) Availability of synthetic primers.
c) Availability of cheap deoxyribonucleotides.
d) Availability of ‘thermostable’ DNA polymerase.

16. Which of the following is not a source of restriction endonuclease?
a) Haemophilus influenza

 b) Escherichia coli
c) Entamoeba 

 d) Bacillus amyloliquifaciens

17. In the genetic engineering process, the recipient’s bacterial cells are made competent by treating them with one of the following
a) Calcium 

 b) Potassium

 c) Cobalt 

 d) Chloride

18. Assertion (A): Primers are used in PCR technique.
Reason (R): These are small chemically synthesized polypeptide molecules.
a) If both A and R are true and R is the correct explanation of A
b) If both A and R are true but R is not the correct explanation of A.
c) If A is true but R is false
d) If both A and R are false

19. A single strand of nucleic acid tagged with a radioactive molecule is called
a) Probe 

 b) Vector 

 c) Selectable marker 

 d) Plasmid

20. pBR322, which is frequently used as a vector for cloning gene in E. coil is a/an
a) Original bacterial plasmid 

 b) Modified bacterial plasmid
c) Viral genome 

 d) Transposon

21. Number of hydrogen bonds in the palindrome sequence identified by EcoRI
a) 8 

 b) 14 

 c) 12 

 d) 24

22. The DNA with the following base sequence is treated with EcoRI. At how many places the enzyme cuts the DNA?
5′ CGAATTCCTGCTTAAGATAT 3
3′ GCTTAAGGACGAATTCTATA 5′
a) 8 

 b) 6 

 c) 1

 d) 2

23. The down streaming process of a biosynthesis product produced in a bio-reactor includes the following steps
a) Denaturation, annealing

 b) Denaturation, separation
c) Separation, purification 

 d) Separation, elution

24. Which of the following characteristics of the plasmid is useful in the last step of r-DNA technology?
a) Presence of palindrome sequence

 b) Presence of antibiotic-resistant genes
c) Presence of cos-sites 

 d) Presence of high molecular weight

25. In gel electrophoresis, separated DNA fragments can be visualized with the help of
a) Acetocarmine in UV radiation

 b) Ethidium bromide in infrared radiation
c) Acetocarmine in bright blue light

 d) Ethidium bromide in UV radiation

26. The correct order of steps in Polymerase Chain Reaction (PCR) is
a) Denaturation, Extension, Annealing

b) Annealing, Extension, Denaturation
c) Extension, Denaturation, Annealing

d) Denaturation, Annealing, Extension

27. The sequence that controls the copy number of the linked DNA in the vector, is termed
a) Palindromic sequence

 b) Recognition site
c) Selectable marker

 d) Ori site

28. Choose the correct pair from the following
a) Nucleases – Separate the two strands of DNA
b) Exonucleases – Make cuts at specific positions within DNA
c) Ligases – Join the two DNA molecules
d) Polymerases – Break the DNA into fragments

29. The ends of DNA fragments are sticky due to
a) Unpaired bases

 b) Calcium ions
c) Endonuclease

 d) Free methylation

30. Match the organism with its use in biotechnology
(a) Bacillus thuringiensis (i) Cloning vector
(b) Thermus aquaticus (ii) Construction of first rDNA molecule
(c) Agrobacterium tumefaciens (iii) DNA polymerase
(d) Salmonella typhimurium (iv) Cry proteins
Select the correct option from the following:
a) a → iii; b → ii; ; c → iv; d → i

 b) a → iii ; b → iv ; c → i; d → ii
c) a → ii ; b → iv ; c → iii ; d → i

 d) a → iv ; b → iii; c → i ; d → ii

31. The sequence of DNA that reads the same backward and forward across the double strand is
a) Recipient sequence

 b) Palindromic sequence
c) Replicate sequence

 d) Origin sequence

32. Which of the following statements are true regarding EcoRI?
(i) The enzyme name has the first letter from bacterial genes.
(ii) The second letter comes from the species.
(iii) The forth letter derived from the name of strain.
(iv) Roman number indicated the order in which the enzymes were isolated from that strain of bacteria.
a) (i), (ii), (iii) and (iv)

 b) (ii), (iii) and (iv)
c) (i) and (ii)

 d) (iii) and (iv)

33. pBR 322 has restriction sites for:
a) Sal I and Cla I

 b) Hind III and Pvu II
c) Pst I and Sal IV

 d) EcoRI and Bam HI

34. Herbert Boyer and Stanley Cohen genetically modified which bacterium:
a) E coli

b) Salmonella

 c) Agrobacterium

d) Bacillus

35. Which enzyme is used to break the membrane to release plant DNA?
a) Lysozyme

 b) Chitinase

 c) Cellulase

 d) All the above

PART B

36. Ideal host for the amplification of DNA molecules is
a) Viruses

 b) Plants

 c) Bacteria

 d) Animals

37. Technology which uses living components for the welfare of human being is…..
a) Biology

 b) Botany

c) Bioinformatics

 d) Biotechnology

38. Which of the following would you choose as the safest and the most cumbersome selectable marker?
a) Ampicillin resistant gene

 b) Tetracycline resistant gene
c) Kanamycin resistant gene

 d) β galactosidase gene

39. A genetically engineered microorganism used successfully in bio remediation of oil spill is species of
a) Trichoderma

b) Xanthomonas

c) Bacillus

d) Pseudomonas

40. EFB stands for……..
a) European Foundation of Biotechnology
b) European Foundation of Biology
c) European Federation of Biotechnology
d) European Foundation of Biology

41. Repeated amplification is achieved by the use of a thermostable DNA polymerase isolated from:
a) Escherichia coli

 b) Bacillus thuringiensis
c) Thermus aquaticus

 d) Salmonella typhimurium

42. Why do bacterial cells contain restriction endonuclease?
a) They help identify mutated regions in the chromosome and initiate the excision repair pathway
b) By selectively binding to particular nucleotide sequences that may appear in viral DNA, the cell can protect itself from infection
c) These help the bacterium open up the DNA in their chromosomes so that transcription is earlier
d) They help the bacterium take up foreign DNA from their environment and combine it into their genome

43. Identify the wrong statements regarding vectors:
(i) Vectors include both cloning vectors and expression vectors.
(ii) pBR 322, pUC 8 are all examples of cloning vectors.
(iii) BAC and YAC are two expression vectors used in Human Genome Project.
(iv) Plasmids are vectors which clone only for small fragments of DNA (10 – 50kb).
(v) Cloning vectors are all artificial vectors.
(vi) Expression vectors are used to make multiple copies of the foreign gene.
(vii) Expression vectors are all natural vectors.
a) (ii), (iii) and (vi) are wrong

 b) (iii), (v), (vi) and (vii) are wrong
c) (iii) and (vi) are wrong

 d) (ii) and (vi) are wrong

44. How many restriction enzymes are known to be isolated?
a) More than 800

 b) More than 700
c) More than 600

 d) More than 900

45. What is temperature required for annealing of DNA molecule?
a) 50-65° C

 b) 30-35° C

 c) 40-45° C

 d) 20-25° C

46. If the transformed host cells with ampicillin resistant gene are spread on agar plates containing ampicillin, which of the following condition results
a) Only transformants will grow and untransformed cells will die
b) Only untransformed cells will grow and transformants will die
c) Both transformants and untransformants will grow
d) Both transformants and untransformants will die

47. Choose the correct statement/s
I. Herbert Boyer worked on Restriction Enzymes of Escherichia coli that cut the DNA to form blunt ends
II. Stanley Cohen studied about the nucleoid of E. coli.
III. Stanley Cohen developed the technique of isolation and introduction of plasmids into bacterial cells.
IV. Herbert Boyer and Stanley Cohen together formed the first genetically modified organism E.coli which was manufacturing plant for antibiotic resistance protein.
a) I, II

 b) I, III 

 c) II, IV

 d) III, IV

48. How many DNA fragments will be obtained on the digestion of a linear DNA and a circular DNA with a type of restriction enzyme having four recognition sites in both the cases?
a) DNA fragments from linear DNA – 4; DNA fragments from circular DNA – 4
b) DNA fragments from linear DNA – 10; DNA fragments from circular DNA – 8
c) DNA fragments from linear DNA – 5; DNA fragments from circular DNA – 4
d) DNA fragments from linear DNA – 8; DNA fragments from circular DNA – 8

49. Match Column I with Column II with respect to the nomenclature of enzyme Eco RI and select the correct option from the codes given below.
Column I Column II
A. E 1. 1st in order of identification
B. co 2. Genus
C. R 3. Species
D. I 4. Strain
A B C D
p) 3 4 1 2
q) 2 3 4 1
r) 2 1 4 3
s) 2 3 1 4
a) p b) q c) r d) s

50. Assertion (A): Plasmids are found naturally in bacteria.
Reason (R): Plasmids are double stranded DNA molecules.
a) Both (A) and (R) are true and (R) is the correct explanation of (A)
b) Both (A) and (R) are true but (R) is not the correct explanation of (A)
c) (A) is true statement but (R) is false
d) Both (A) and (R) are false statements

=====================================================================
KEY- BIOTECHNOLOGY PRINCIPLES AND PROCESSES
====================================================================